DNA sequencing gel Forward reaction DNA sequence (e value: 5e-44) GCCGTTGTTGAGTCGCAACAAAAAGCCCCCACCTTTCGGTGGGGGCTTTCCGATTCAACTGACGCTGAATCTTTTGGAGACTTCAGCCTCAGCCGATGGCG Reverse reaction DNA sequence (e value: 5e-44) GGCATCCGTGAGCCCGTCGCTGGCTCCCTGATCTACGGCAACAACATCATCTCCGGTGCTGTTGTGCCCTCCTCGAACGCCATCGGCCTTCACTTCTATCC The sequenced gene belongs to the psbA multigene family and codes for the D1 protein of photosystem II (PSII) in cyanobacteria such as Synechococcus WH7803. The D1 protein forms the core of the PSII’s reaction centre … Read More
Category Archives: Biology
Southern Blot Technique to Detect the Ultrabithorax Gene
Using the Southern Blot Technique to Detect the Ultrabithorax gene in the Genomic DNA of the Drosophila melanogaster and the pET19 – Ubx plasmid Post Digestion by BamHI, NdeI, and BanII Restriction Enzymes Abstract: The Southern blot technique is used to detect targeted DNA sequences in DNA containing samples. In order to run the sample on an agarose gel … Read More
The Human Spleen: Functions and Importance
The Human Spleen Description The spleen is an organ system located in the upper far left part of the abdomen, to the left of the stomach. I chose to discuss this organ because it is often neglected as essential and I wanted to know how it impacts one’s health. This organ fluctuates in size … Read More
Cerebral Infarction of the Uygur and Han Ethnic Groups
Research Article The Difference of the Polymorphism of RS4360791 Loci of ALOX5AP Gene between Cerebral Infarction of the Uygur andHan Ethnic Groups InXinjiang 1. Abstract Objective:To explore the difference of the polymorphism of RS4360791 loci of ALOX5AP gene between cerebral infarction of the Uygur and Han ethnic groups in Xinjiang Province, China. Methods:This is … Read More
Handroanthus impetiginosus (Mart. ex DC.) Mattos Analysis
Handroanthusimpetiginosus (Mart. ex DC.) Mattos “Ipê roxo”, “ipê rosa” or “pink lapacho” “Ipê roxo is a common name for Handroanthusimpeginosus. “Ipê” is a tupi[1] word that main “thick bark tree” and “roxo” is a Brazilian word for purple. Even the flowers being pink the most common name for the tree is purple ipê. The group of Ipês are broadly used in … Read More
Effect of Exposure to Synthetic Estrogen on Fish Populations
The Effect of Exposure to Synthetic Estrogen on Fish Populations In a world full of pharmaceutical drugs and hormone replacement, pharmacists and toxicologists alike squabble with the implications of improper chemical disposal. Fewer professionals fully analyze how these chemicals are making it into the aquatic environment in ways other than improper disposal and to the … Read More
Sexual and Asexual Reproduction in Plants
Compare and contrast sexual and asexual reproduction in plants and give medicinal plant examples. Introduction Plants are eukaryotic organisms that evolved over billions of years. There is enormous diversity in reproductive strategy in plants. Eukaryotes have nuclei in each cell that contain DNA coiled into chromosomes. Chromosomes are the organism’s reproductive functional unit and occur in single … Read More
How Did the Cat Evolve to Become Tame?
How did moggy become so tame? History In Cyprus 9.5 kya, and later Asia, as humans shifted towards more agricultural lifestyles, we see the first evidence of the domestic cat (Felis silvestirs catus) 1, 2. This may have been a result of the benefit cats provide farmers through vermin control. Today, the domestic cat is one of … Read More
attraction response of mosquitoes when exposed to CDC light traps
Master’s degree proposal Introduction Aedes aegypti As a well-known vector of diseases such as Yellow Fever, Dengue, Chikungunya, and Zika virus the Aedes aegypti have remained a global health issue. The ancestral roots of this species are suspected to have begun in the sub-Saharan region on the continent of Africa as a tree-hole laying mosquito that feeds … Read More
CGRP Receptor Activation Mechanism and Applications
CGRP Receptor activation Proposal Summary The calcitonin gene-related peptide (CGRP) receptor is a complex of calcitonin receptor-like receptor (CLR) and receptor activity-modifying protein 1 (RAMP1). This receptor plays an important role in vasodilation, neurogenic inflammation and is involved in the pathology of migraine. Though mechanisms have been proposed, it is largely unknown how exactly the … Read More
Developmental Process of Human Spermatozoa
Human spermatozoa take 74 days to complete their development. Discuss the developmental significance of the process by breaking this period down into the main stages of spermatogenesis, describing them in relation to where in the male reproductive tract these stages are found. The ability of a species to reproduce is a characteristic seen across every domain … Read More
Evolution of the Human Hand
The Evolution of the Human Hand Introduction The hand is one of the most discernible features of humankind. A key advantage to hominin evolution is the advancement of dexterity and structure of the human thumb. Modern homo sapiens possess a highly distinct thumb considerably stronger than any other digit. Compared to other apes, humans have … Read More
Unique Function of P53 Homolog P63
P53 homolog p63 has a unique function P53 is commonly known as a transcription factor and is well characterized for its role in DNA damage and cell cycle control (1), but less is known about its related homologous genes, p63 and p73 (2). While p63 and p73 are very similar in structure to p53, recent literature … Read More
How can Aspartate Aminotransferases be Exploited in Biocatalysis?
How can Aspartate Aminotransferases be Exploited in Biocatalysis? Background and structure: Aminotransferases (transaminases) are very useful in pharmaceutical drug discovery because of their ability to introduce chirality into amines or amine derived compounds. Aspartate aminotransferase catalyses the reversible transfer of an alpha amino group between aspartate and glutamate. A well-known example of aminotransferases in the … Read More
Atomic Force Microscopy (AFM) to Obtain Biological Information
How can AFM be used to obtain biological information across a wide range of scales from cell structure and function to single molecule detection? Atomic Force Microscopy (AFM) is a scanning probe microscopy technique which is commonly used not only for the observation but also for the manipulation of biological macromolecules. This technique is … Read More
Wheat Disease Resistance like Gene
A UNIQUE WHEAT DISEASE RESISTANCE LIKE GENE GOVERNS EFFETOR TRIGGERED SUCEPTIBILITY TO NECROTROPHIC PATHOGENS ABSTRACT Tan spot is an important foliar disease of wheat caused by Pyrenophora tritici-repentis. Eight races of this fungus have been identified based on their virulence on a wheat differential set. It is a devastating foliar disease of wheat caused by … Read More
Glomeruli and Glomerular Filtration Rate (GFR)
The glomeruli are microscopic filters made of a network of capillaries that filter the blood plasma, which occurs in the renal corpuscle of the nephron in the kidneys (figure 1). Glomerular filtration rate (GFR) is defined by amount of blood filtered by the glomerulus into the Bowman’s capsule (ml/per unit of time), the resulting fluid … Read More
Laboratory Investigation of Gastrointestinal Stromal Tumour
Title: Describe the laboratory investigation of GIST. Gastrointestinal Stromal Tumour (GIST) is one of the most commonly seen mesenchymal neoplasms, a soft tissue sarcoma, present in any area of the gastrointestinal tract (GI tract) and can have extra-gastrointestinal involvement as well. The stomach is the most common site (about 70%). GIST mainly affects middle aged to … Read More
Importance of Gene Editing and CRISPR | Argument
A detailed explanation of why I think Gene editing and CRISPR are important topics in current biology. The ability to change the DNA of an organism is called gene editing, this technology allows genetic material to be removed, added or altered. This technology was first accomplished in 1972 by Herbert Boyer and Stanley Cohen, since … Read More
Methods of Transport across a Plasma Membrane Biology
Methods of Transport across a Plasma Membrane Biology The plasma membrane is present in both the eukaryotic and prokaryotic cell and is also known as the biological membrane and. It works as a barrier between the inner and outer surface of a cell hence is also called the cell membrane. In plant cells it is … Read More
Plant Growth Experiment: Corn, Sorghum, Cotton, Green Bean, and Potato
Plant Growth Experiment Plants play a big role in our everyday lives whether you are at a super market, to the department store, fast food or any restaurant. The clothes you have on more than likely are made of some type of fiber coming from a plant called cotton. You probably have had foods with … Read More
Determining Reactants for Photosynthesis
Photosynthesis Lab Purpose: The purpose of this investigation is study is to determine if reactants such as, light, carbon dioxide or chlorophyll, are essential for photosynthesis to take place. This will be determined through the iodine test, the presence of starch can be determined within the leaves of a geranium plant, variegated plant, and two … Read More
Super-Resolution Fluorescence Microscopy by Single-Molecule Switching
Super-Resolution Fluorescence Microscopy by Single-Molecule Switching Biological research has been greatly impacted by the invention of fluorescent microscopy (Thorley, Pike and Rappoport, 2014). Although the impact on describing biological processes is revolutionary, diffraction of light is a limiting factor that blurs objects smaller than 250 nm in the x and y direction, and 500 nm … Read More
Digestive System of a Dog
This essay is going to explain the digestive system of a dog, focusing on how the structure aids the function. The digestive system consists of a collection of organs that all have a variety of roles in order to break down food and absorb nutrients. Figure 1 shows the gastrointestinal (GI) tract of a dog … Read More
Myosin: A Superfamily of Motor Proteins
Myosin: A Superfamily of Motor Proteins Introduction Every movement, from moving one’s fingers to looking around, is powered by myosin; myosin is one of only three proteins which are responsible for converting chemical energy into kinetic and mechanical work.1. It consists of a large family of motor proteins which are renowned for their various … Read More
The Interrelationship Between the Systems of the Human Body
This essay was produced by one of our professional writers as a learning aid to help you with your studies The Interrelationship Between the Systems of the Human Body Introduction This essay will consider the structure and function of the 11 systems within the human body. It will detail the interrelationship between the nervous system … Read More
Example 2:1 Biology Essay
This essay was produced by one of our professional writers as a learning aid to help you with your studies Example 2:1 Biology Essay NHS Cervical Screening Programme: Liquid Based Cytology vs. Conventional Cytology Introduction Cervical screening, such as the regular programme provided by the NHS, is a very successful way of detecting the early … Read More
Fossil Record Evidence for Evolution
This essay was produced by one of our professional writers as a learning aid to help you with your studies The Fossil Records and Theories of Evolution. Introduction In general, the term ‘evolution’ can imply a drastic or gradual change from a very broad perspective. Life on earth, the universe,galaxies, as also the earth in … Read More
High Throughput Screening (HTS) Assays: Uses and Formats
the authors and do not necessarily reflect the views of UK Essays. The increasing demands placed upon the pharmaceutical industry to produce a rapid turnaround of new drugs is a driving factor in the automation of the processes at the initial screening stage of drug discovery. This has lead to the development of numerous high … Read More
Absent Joining Chain Effect on Immune Response
the authors and do not necessarily reflect the views of UK Essays. Critical Review of a Journal Kallberg, E. and Leanderson, T., 2006. Joining-chain (J-chain) negative mice are B cell memory deficient. European Journal of Immunology, 36, 1398-1403. Overview The journal article falls under the main subject area of cellular immune response, where the effect … Read More
Impact of PCR (Polymerase Chain Reaction) on Biology
the authors and do not necessarily reflect the views of UK Essays. PCR- How has this technique revolutionised molecular biology in the last 30 years? PCR (Polymerase Chain Reaction) has been in existence for several decades now and in that time has become one of the most commonly used of all lab techniques in biology. … Read More
ATP and Adenosine: Biochemistry and Metabolism
the authors and do not necessarily reflect the views of UK Essays. ATP and adenosine: biochemistry and metabolism Adenosine triphosphate (ATP) is an endogenously occurring nucleoside triphosphate, which is ubiquitous in all cell types and constitutes the natural precursor molecule of adenosine, (AD) a purine nucleoside formed by adenine and ribose. One ATP molecule consists of three … Read More
Role Of Bacteria In Assisting Cancer
Cancer can be promoted by several pathogenic bacteria to initiate abnormal cell growth by attacking the immune system or suppressing apoptosis (Mager 2006). However, bacterial toxins can still be used for tumor suppressor and cancer vaccines on immunotoxins of bacterial origin(Patyar et al. 2010). Bacterial colonization of tumors was initially attributed to the hypoxic nature of … Read More
CD8+ effector and memory T cells Differentiation
the authors and do not necessarily reflect the views of UK Essays. What controls CD8+ effector and memory T cells differentiation? Introduction: The capability of initiating and cultivating a population of memory T cells is the key component of an effective adaptive immune response and the fundamental foundation for a productive vaccine since memory cells … Read More
Analyzing the Phylum Chordata through Biology
the authors and do not necessarily reflect the views of UK Essays. Hamza Ali Introduction: The topic chosen for this biological study was the Kingdom Animalia. This study will specifically be analyzing the Phylum Chordata, by providing an introduction to Chordates, Vertebrates, The Classification method of Cladistics, Fish, Amphibian, and Reptiles. What are vertebrates? -Vertebrates … Read More
Functions of Food and Food Types
Introduction: A look over past decade shows an evident surge of consumer concern towards the health augmenting role of some specific foods which are refer as functional foods. Evidently all foods that we consume are functional in nature as they dispense specific aroma, taste and nutritive value, however during last decade the term has been … Read More
Screening of Exopolysaccharides Producing Bacteria Strains
the authors and do not necessarily reflect the views of UK Essays. 1.0 Introduction Among the microbial products, exopolysaccharides (EPSs) play a significant role in main physiological functions and applications. The increased demand for current and natural polymeric materials by several industrial fields such as pharmaceutical, food and others has moved the interest to the … Read More
Blood Protozoan Disease Theileriosis: Causes and Prevalence
the authors and do not necessarily reflect the views of UK Essays. The genesis of the problem has been the introduction of the 6 cows from Rajasthan, a hot and dry state of India in the Holstein cross bred herd in the Graphic Era University dairy at Dehradun capital of hill state of India. Suddenly … Read More
Analysis of Water Quality in South Africa’s Rivers
the authors and do not necessarily reflect the views of UK Essays. Diseases Related to Microbial Organism’s found in the drinking water in South Africa Shelley-Anne Bentham Due: 17 March 2014 Definitions: cfu/ml: Colony Forming Units per mililitre Keywords: Cholera, Entamoeba Histolticia, Giardia Lamblia and Tricuris Trichuira, Rota Virus, Salmonella Abstract Aim: Is to determine the quality of water … Read More
Bluetongue Virus (BTV): Causes, Types and History
the authors and do not necessarily reflect the views of UK Essays. The disease was first reported in Pakistan in 1959 and in India in 1964 (Sapre, 1964). After that BT outbreaks have been reported from sheep and goat in several states of India. Being India endemic for BT, 21 different serotypes of BTV have … Read More
Declining Honey Bee Population: Causes and Effects
the authors and do not necessarily reflect the views of UK Essays. Abstract Introduction Honey Bee (Apis mellifera) numbers have declined significantly in recent years and there are numerous theories as to why. One of the fore runners is the emergence of Colony Collapse Disorder (CCD), which is: “an unsolved decline in honey bees from … Read More
Using Fish Geometric Morphometric Markers
the authors and do not necessarily reflect the views of UK Essays. Use of Fish Geometric Morphometric Markers for Characterizing Shape Variations of Selected Fishes: Family Leiognathidae in the Marine Waters of Zamboanga City, Western Mindanao, Philippines Roldan T. Echem Abstract [AU1] In this investigation, geometric morphometric analysis was used to determine the extent and … Read More
Therapeutic Effects of Caffeine
Abstract Caffeine which is part of many beverages like tea, coffee, energy drinks, cola drinks and chocolates is one of the widely used stimulants by the human population all over the world. The consumption of caffeine varies across age groups. Generally adults follow a pattern in the consumption related to the time of the day, … Read More
Relationship Between Myofibroblasts and Progenitor Cells
the authors and do not necessarily reflect the views of UK Essays. Introduction The liver is an organ with high regenerative ability in case of massive parenchymal cell loss it can restore its mass. Even if often thought of in the circumstance of acute liver damage. The liver reconstitution and regeneration are also related with … Read More
Life Cycle of the G. Lamblia
Thuy Truc Pham Giardiasis Giardiasis, which is a protozoan infection in human, is caused by Giardia lamblia (synonyms as Giardia intestinalis or Giardia duodenalis). This disease is sometimes known as traveller’s diarrhoea, causing problems all around the world. The causative agent presents in two distinct forms: the disease-causing trophozoite and the dormant infectious cyst. This essay is to review the … Read More
Oil Degrading Bacteria: History of and Processes
the authors and do not necessarily reflect the views of UK Essays. Oil Degrading Bacteria Introduction Oil degrading bacteria are considered as the dominant hydrocarbon which helps in degrading the aquatic systems such as oceans. These bacteria’s are capable of diverse metabolic pathways which enable them to utilize most recalcitrant petroleum hydrocarbons that are not … Read More
Protein Precipitation & Isolation of Casein from Milk
the authors and do not necessarily reflect the views of UK Essays. A. Dilshan Jayawickrama Protein Precipitation Methods and Isolation of Casein from Milk Introduction Protein is one of the major constituent of all living organisms on earth which are made up of in a sequence of amino acid. They are linear polymers of amino … Read More
Master Genes Involved in Cotton Fiber Development
the authors and do not necessarily reflect the views of UK Essays. Cotton fibers are seed trichomes, which are single celled and arose from the epidermal layers of ovules. Fibre formation in cotton has divided into four distinct stages viz; fibre initiation, elongation, secondary cell wall accumulation and maturation. In fiber initiation stage up to … Read More
Oxygen Production During Photosynthesis
the authors and do not necessarily reflect the views of UK Essays. Oxygen Production During Photosynthesis Meera Kapadia and Amirah Mohd Ariff Abstract The purpose of this experiment was to investigate the role of light in the production of oxygen gas through photosynthesis. The independent variable for this investigation was the time elapsed between … Read More
α-glucosidase Inhibitory Effect of Coffee
the authors and do not necessarily reflect the views of UK Essays. Abstract The activity-based fractionation of coffee solutions by a series of chromatography techniques led to the isolation of an active compound I which exhibited a strong inhibitory activity against α-glucosidase. The structure of compound I was established as norharman (9H-pyrido[3.4-b]indole) on the basis … Read More
